Genmutationer och dess konsekvenser:

s. 52 + 64 i boken


Det här är en gen:

TACCCGGCATAGATACCGCCGTTA

Ursprunglig sekvens av aminosyror som genen kodar för (s. 52):

Met, Gly, Arg, Ile, Tyr, Gly, Gly, Asn

proteinet är ett enzym som har som funktion att bryta ner laktos.


Dessa ”fel” kan ske vid replikationen:

1) Det tillkommer en kvävebas

2) Det försvinner en kvävebas

3) En kvävebas byts ut mot en annan

4) En kvävebas byts ut mot en annan


-Vilka konsekvenser får följande genmutationer?



Exempel 1:

DNA: TACCCGTGCATAGATACCGCCGTTA





Exempel 2:

DNA: TACCCGGCATA ATACCGCCGTTA





Exempel 3:

DNA: TACCCGGCATAGATTCCGCCGTTA





Exempel 4:

DNA: TACCCGGCATAGATACCACCGTTA






Den genetiska koden:




















https://www.djur.cob.lu.se/Svar/Evol.html#livet-gemensamt-ursprung-genetiska-koden-eukaryoter-bakterier-arkeer


Aminosyror: